Basic information for Gm45425-201-10aa
| Peptide Name | Gm45425-201-10aa |
| Genome Position | chr8:85610356-85610385[+] |
| Species | Mouse |
| Peptide Sequence | MAHLWFRPLS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.31 |
| Relative Molecular Mass | 1419.63 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000109731;Gm45425 |
| Transcript ID/Name | ENSMUST00000211727;Gm45425-201 |
| Transcript Length | 618 |
| Coding Ability | 0.4337 |
| DNA Sequence Corresponding to Peptide | ATGGCACACCTCTGGTTTAGGCCACTCAGT |
m6A
|
Conservation
|
|
|