Basic information for Gm46409-202-10aa-1
| Peptide Name | Gm46409-202-10aa-1 |
| Genome Position | chr13:36618507-36618536[+] |
| Species | Mouse |
| Peptide Sequence | MGGSLCEISK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.29 |
| Relative Molecular Mass | 1186.35 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000114851;Gm46409 |
| Transcript ID/Name | ENSMUST00000225239;Gm46409-202 |
| Transcript Length | 5740 |
| Coding Ability | 0.4136 |
| DNA Sequence Corresponding to Peptide | ATGGGGGGTTCACTATGTGAAATTTCCAAA |
|
Conservation
|
|
|