Basic information for Gm46430-206-10aa
| Peptide Name | Gm46430-206-10aa |
| Genome Position | chr13:74612886-74612915[-] |
| Species | Mouse |
| Peptide Sequence | MLLCRSSSTS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.36 |
| Relative Molecular Mass | 1246.43 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000113204;Gm46430 |
| Transcript ID/Name | ENSMUST00000222064;Gm46430-206 |
| Transcript Length | 1647 |
| Coding Ability | 0.4366 |
| DNA Sequence Corresponding to Peptide | ATGCTGTTGTGCAGATCTTCATCCACATCT |
|
Conservation
|
|
|