Basic information for Gm46430-209-10aa
| Peptide Name | Gm46430-209-10aa |
| Genome Position | chr13:74617825-74617854[-] |
| Species | Mouse |
| Peptide Sequence | MLCPLPPLGG |
| Peptide Length | 10 |
| Unique | No (Gm46430-208-10aa) |
| Grand Average of Hydropathicity | 1.02 |
| Relative Molecular Mass | 1159.41 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000113204;Gm46430 |
| Transcript ID/Name | ENSMUST00000222430;Gm46430-209 |
| Transcript Length | 736 |
| Coding Ability | 0.1304 |
| DNA Sequence Corresponding to Peptide | ATGCTGTGTCCTCTCCCACCGCTTGGAGGA |
m6A
|
Conservation
|
|
|