Basic information for Gm46603-202-10aa-1
| Peptide Name | Gm46603-202-10aa-1 |
| Genome Position | chr17:29320446-29320475[-] |
| Species | Mouse |
| Peptide Sequence | MSVVIFVCPA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.37 |
| Relative Molecular Mass | 1227.49 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000117592;Gm46603 |
| Transcript ID/Name | ENSMUST00000234551;Gm46603-202 |
| Transcript Length | 2437 |
| Coding Ability | 0.4021 |
| DNA Sequence Corresponding to Peptide | ATGTCAGTTGTGATTTTTGTGTGCCCTGCG |
|
Conservation
|
|
|