Basic information for Gm47106-201-10aa-2
| Peptide Name | Gm47106-201-10aa-2 |
| Genome Position | chr9:105087997-105088026[-] |
| Species | Mouse |
| Peptide Sequence | MGQFQYFCIY |
| Peptide Length | 10 |
| Unique | No (Gm47578-201-10aa-5) |
| Grand Average of Hydropathicity | 0.45 |
| Relative Molecular Mass | 1461.67 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000111044;Gm47106 |
| Transcript ID/Name | ENSMUST00000213142;Gm47106-201 |
| Transcript Length | 832 |
| Coding Ability | 0.3113 |
| DNA Sequence Corresponding to Peptide | ATGGGACAATTTCAATATTTTTGTATCTAT |
|
Conservation
|
|
|