Basic information for Gm47138-201-10aa-1
| Peptide Name | Gm47138-201-10aa-1 |
| Genome Position | chr12:99368464-99368493[-] |
| Species | Mouse |
| Peptide Sequence | MPLAVFSLSL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.89 |
| Relative Molecular Mass | 1239.46 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000113003;Gm47138 |
| Transcript ID/Name | ENSMUST00000223213;Gm47138-201 |
| Transcript Length | 3370 |
| Coding Ability | 0.3973 |
| DNA Sequence Corresponding to Peptide | ATGCCTCTGGCTGTTTTCTCCCTCAGTCTA |
m6A
|
Conservation
|
|
|