Basic information for Gm47493-201-10aa-2
| Peptide Name | Gm47493-201-10aa-2 |
| Genome Position | chr13:12051800-12051829[-] |
| Species | Mouse |
| Peptide Sequence | MTRLGVICVS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.47 |
| Relative Molecular Mass | 1240.53 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000112947;Gm47493 |
| Transcript ID/Name | ENSMUST00000220599;Gm47493-201 |
| Transcript Length | 4714 |
| Coding Ability | 0.4185 |
| DNA Sequence Corresponding to Peptide | ATGACAAGATTGGGTGTTATTTGTGTGTCA |
|
Conservation
|
|
|