Basic information for Gm47578-201-10aa-1
| Peptide Name | Gm47578-201-10aa-1 |
| Genome Position | chr10:99720685-99720714[+] |
| Species | Mouse |
| Peptide Sequence | MVLAPLSKIK |
| Peptide Length | 10 |
| Unique | No (Gm4117-201-10aa-3,Gm37788-201-10aa-1,Gm47221-201-10aa,Gm48765-201-10aa,AC160336.1-201-10aa-7,AC160336.1-201-10aa-15,AC160336.1-201-10aa-49,AC103362.1-201-10aa-2) |
| Grand Average of Hydropathicity | 0.98 |
| Relative Molecular Mass | 1261.56 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000113032;Gm47578 |
| Transcript ID/Name | ENSMUST00000222959;Gm47578-201 |
| Transcript Length | 6046 |
| Coding Ability | 0.4752 |
| DNA Sequence Corresponding to Peptide | ATGGTTTTAGCTCCCTTGTCGAAGATCAAG |
|
Conservation
|
|
|