Basic information for Gm47739-201-10aa-3
| Peptide Name | Gm47739-201-10aa-3 |
| Genome Position | chr10:53572641-53572670[-] |
| Species | Mouse |
| Peptide Sequence | MLLLKPPFTD |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.48 |
| Relative Molecular Mass | 1336.62 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000112731;Gm47739 |
| Transcript ID/Name | ENSMUST00000219731;Gm47739-201 |
| Transcript Length | 2705 |
| Coding Ability | 0.3006 |
| DNA Sequence Corresponding to Peptide | ATGCTTCTGCTAAAACCACCATTCACGGAC |
m6A
|
Conservation
|
|
|