Basic information for Gm47882-201-10aa-2
| Peptide Name | Gm47882-201-10aa-2 |
| Genome Position | chr13:13893634-13893663[+] |
| Species | Mouse |
| Peptide Sequence | MLYYKIVLYY |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.91 |
| Relative Molecular Mass | 1530.82 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000113811;Gm47882 |
| Transcript ID/Name | ENSMUST00000223012;Gm47882-201 |
| Transcript Length | 3476 |
| Coding Ability | 0.3248 |
| DNA Sequence Corresponding to Peptide | ATGCTTTACTATAAAATTGTACTATATTAT |
|
Conservation
|
|
|