Basic information for Gm48203-201-10aa
| Peptide Name | Gm48203-201-10aa |
| Genome Position | chr10:105393594-105393623[-] |
| Species | Mouse |
| Peptide Sequence | MLGSFVCLFV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.48 |
| Relative Molecular Mass | 1277.55 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000112512;Gm48203 |
| Transcript ID/Name | ENSMUST00000219124;Gm48203-201 |
| Transcript Length | 1785 |
| Coding Ability | 0.3221 |
| DNA Sequence Corresponding to Peptide | ATGCTTGGATCCTTTGTTTGTTTGTTTGTT |
m6A
|
Conservation
|
|
|