Basic information for Gm48421-201-10aa
| Peptide Name | Gm48421-201-10aa |
| Genome Position | chr12:64197219-64197248[+] |
| Species | Mouse |
| Peptide Sequence | MCVSVSFACF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.11 |
| Relative Molecular Mass | 1255.48 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000113208;Gm48421 |
| Transcript ID/Name | ENSMUST00000222001;Gm48421-201 |
| Transcript Length | 489 |
| Coding Ability | 0.1963 |
| DNA Sequence Corresponding to Peptide | ATGTGTGTCTCTGTCTCTTTTGCCTGTTTT |
|
Conservation
|
|
|