Basic information for Gm48619-201-10aa
| Peptide Name | Gm48619-201-10aa |
| Genome Position | chr12:6801620-6801649[+] |
| Species | Mouse |
| Peptide Sequence | MSNITLLLFF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.84 |
| Relative Molecular Mass | 1360.64 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000112454;Gm48619 |
| Transcript ID/Name | ENSMUST00000220141;Gm48619-201 |
| Transcript Length | 2262 |
| Coding Ability | 0.4125 |
| DNA Sequence Corresponding to Peptide | ATGAGTAATATTACTTTATTACTTTTCTTT |
|
Conservation
|
|
|