Basic information for Gm48838-201-10aa-1
| Peptide Name | Gm48838-201-10aa-1 |
| Genome Position | chr13:3562989-3563018[+] |
| Species | Mouse |
| Peptide Sequence | MSLPVWSRYL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.38 |
| Relative Molecular Mass | 1413.62 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000113894;Gm48838 |
| Transcript ID/Name | ENSMUST00000223046;Gm48838-201 |
| Transcript Length | 1234 |
| Coding Ability | 0.299 |
| DNA Sequence Corresponding to Peptide | ATGAGCCTACCTGTATGGTCAAGGTATTTG |
m6A
|
Conservation
|
|
|