Basic information for Gm48899-201-10aa
| Peptide Name | Gm48899-201-10aa |
| Genome Position | chr13:67472488-67472517[+] |
| Species | Mouse |
| Peptide Sequence | MSLWSFLQNP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.12 |
| Relative Molecular Mass | 1384.54 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000114788;Gm48899 |
| Transcript ID/Name | ENSMUST00000223925;Gm48899-201 |
| Transcript Length | 737 |
| Coding Ability | 0.2605 |
| DNA Sequence Corresponding to Peptide | ATGAGTTTATGGAGCTTCCTACAAAACCCA |
m6A
|
Conservation
|
|
|