Basic information for Gm49165-201-10aa-3
| Peptide Name | Gm49165-201-10aa-3 |
| Genome Position | chr14:73713368-73713397[-] |
| Species | Mouse |
| Peptide Sequence | MGPHKIAKFL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.18 |
| Relative Molecular Mass | 1303.57 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000115088;Gm49165 |
| Transcript ID/Name | ENSMUST00000226391;Gm49165-201 |
| Transcript Length | 2929 |
| Coding Ability | 0.4609 |
| DNA Sequence Corresponding to Peptide | ATGGGACCTCATAAAATTGCAAAGTTTCTG |
|
Conservation
|
|
|