Basic information for Gm49364-202-10aa-1
| Peptide Name | Gm49364-202-10aa-1 |
| Genome Position | chr14:44958346-44958375[-] |
| Species | Mouse |
| Peptide Sequence | MNGGCLHFKI |
| Peptide Length | 10 |
| Unique | No (4930431P03Rik-201-10aa,4930431P03Rik-202-10aa-1,4930431P03Rik-204-10aa) |
| Grand Average of Hydropathicity | 0.41 |
| Relative Molecular Mass | 1281.51 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000115344;Gm49364 |
| Transcript ID/Name | ENSMUST00000227028;Gm49364-202 |
| Transcript Length | 4669 |
| Coding Ability | 0.4633 |
| DNA Sequence Corresponding to Peptide | ATGAATGGTGGCTGCTTACATTTTAAAATT |
|
Conservation
|
|
|