Basic information for Gm49534-201-10aa-2
| Peptide Name | Gm49534-201-10aa-2 |
| Genome Position | chr16:7870955-7870984[+] |
| Species | Mouse |
| Peptide Sequence | MGQFQYFCVC |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.8 |
| Relative Molecular Mass | 1387.62 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000116450;Gm49534 |
| Transcript ID/Name | ENSMUST00000230593;Gm49534-201 |
| Transcript Length | 3886 |
| Coding Ability | 0.3659 |
| DNA Sequence Corresponding to Peptide | ATGGGACAATTTCAATATTTTTGTGTCTGT |
|
Conservation
|
|
|