Basic information for Gm49784-201-10aa
| Peptide Name | Gm49784-201-10aa |
| Genome Position | chr17:17594472-17594501[-] |
| Species | Mouse |
| Peptide Sequence | MSLALGTPDP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.27 |
| Relative Molecular Mass | 1163.32 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000116796;Gm49784 |
| Transcript ID/Name | ENSMUST00000232626;Gm49784-201 |
| Transcript Length | 1094 |
| Coding Ability | 0.4625 |
| DNA Sequence Corresponding to Peptide | ATGAGCTTAGCTTTAGGTACACCTGATCCC |
m6A
|
Conservation
|
|
|