Basic information for Gm49838-201-10aa-2
| Peptide Name | Gm49838-201-10aa-2 |
| Genome Position | chr17:28425765-28425794[-] |
| Species | Mouse |
| Peptide Sequence | MGSPVLFLAR |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.1 |
| Relative Molecular Mass | 1252.47 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000117313;Gm49838 |
| Transcript ID/Name | ENSMUST00000233201;Gm49838-201 |
| Transcript Length | 1708 |
| Coding Ability | 0.3806 |
| DNA Sequence Corresponding to Peptide | ATGGGTTCTCCCGTGCTTTTTCTTGCCAGA |
m6A
|
Conservation
|
|
|