Basic information for Gm49971-201-10aa-4
| Peptide Name | Gm49971-201-10aa-4 |
| Genome Position | chr18:46766569-46766598[+] |
| Species | Mouse |
| Peptide Sequence | MNVAALASGA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.24 |
| Relative Molecular Mass | 1066.17 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000117599;Gm49971 |
| Transcript ID/Name | ENSMUST00000234242;Gm49971-201 |
| Transcript Length | 4895 |
| Coding Ability | 0.3273 |
| DNA Sequence Corresponding to Peptide | ATGAATGTGGCTGCCCTTGCATCTGGAGCA |
|
Conservation
|
|
|