Basic information for Gm5420-201-10aa
| Peptide Name | Gm5420-201-10aa |
| Genome Position | chr10:21693381-21693410[+] |
| Species | Mouse |
| Peptide Sequence | MQLKNQSLLC |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.06 |
| Relative Molecular Mass | 1339.58 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000056716;Gm5420 |
| Transcript ID/Name | ENSMUST00000071008;Gm5420-201 |
| Transcript Length | 2206 |
| Coding Ability | 0.5712 |
| DNA Sequence Corresponding to Peptide | ATGCAATTGAAAAACCAAAGCCTTTTGTGC |
|
Conservation
|
|
|