Basic information for Gm6639-202-10aa
| Peptide Name | Gm6639-202-10aa |
| Genome Position | chr3:35618825-35618854[-] |
| Species | Mouse |
| Peptide Sequence | MLCIKHPYLL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.03 |
| Relative Molecular Mass | 1392.72 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000105662;Gm6639 |
| Transcript ID/Name | ENSMUST00000196841;Gm6639-202 |
| Transcript Length | 2666 |
| Coding Ability | 0.542 |
| DNA Sequence Corresponding to Peptide | ATGTTGTGTATTAAACATCCTTATCTATTA |
|
Conservation
|
|
|