Basic information for HCG11-201-10aa-1
| Peptide Name | HCG11-201-10aa-1 |
| Genome Position | chr6:26522840-26522869[+] |
| Species | Human |
| Peptide Sequence | MYVVDNAKLF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.65 |
| Relative Molecular Mass | 1361.56 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000228223;HCG11 |
| Transcript ID/Name | ENST00000411553;HCG11-201 |
| Transcript Length | 5696 |
| Coding Ability | 0.4705 |
| DNA Sequence Corresponding to Peptide | ATGTATGTAGTTGACAATGCTAAGCTTTTT |
m6A
|
Conservation
|
|
|