Basic information for HCG11-201-10aa-4
| Peptide Name | HCG11-201-10aa-4 |
| Genome Position | chr6:26526762-26526791[+] |
| Species | Human |
| Peptide Sequence | MCPYVSIFTF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.43 |
| Relative Molecular Mass | 1369.64 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000228223;HCG11 |
| Transcript ID/Name | ENST00000411553;HCG11-201 |
| Transcript Length | 5696 |
| Coding Ability | 0.4705 |
| DNA Sequence Corresponding to Peptide | ATGTGTCCATATGTGTCCATATTTACATTT |
|
Conservation
|
|
|