Basic information for HELLPAR-201-10aa-13
| Peptide Name | HELLPAR-201-10aa-13 |
| Genome Position | chr12:102262784-102262813[+] |
| Species | Human |
| Peptide Sequence | MKNVSDLGIT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.16 |
| Relative Molecular Mass | 1239.43 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000281344;HELLPAR |
| Transcript ID/Name | ENST00000626826;HELLPAR-201 |
| Transcript Length | 205012 |
| Coding Ability | 0.3892 |
| DNA Sequence Corresponding to Peptide | ATGAAGAATGTGAGTGATTTAGGAATCACA |
|
Conservation
|
|
|