Basic information for HELLPAR-201-10aa-96
| Peptide Name | HELLPAR-201-10aa-96 |
| Genome Position | chr12:102263068-102263097[+] |
| Species | Human |
| Peptide Sequence | MPVIPALWEA |
| Peptide Length | 10 |
| Unique | No (CPEB1-AS1-202-10aa-3,AP003969.2-201-10aa-2,AC141586.5-201-10aa,AC009044.1-201-10aa) |
| Grand Average of Hydropathicity | 1.04 |
| Relative Molecular Mass | 1288.49 |
| Experimental Evidences | 2:IRES,ribo |
| lncRNA ID/Name | ENSG00000281344;HELLPAR |
| Transcript ID/Name | ENST00000626826;HELLPAR-201 |
| Transcript Length | 205012 |
| Coding Ability | 0.3892 |
| DNA Sequence Corresponding to Peptide | ATGCCTGTAATCCCAGCACTTTGGGAGGCC |
IRES
|
Conservation
|
|
|