Basic information for HELLPAR-201-10aa-97
| Peptide Name | HELLPAR-201-10aa-97 |
| Genome Position | chr12:102263830-102263859[+] |
| Species | Human |
| Peptide Sequence | MGTVVARGAI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.24 |
| Relative Molecular Mass | 1136.36 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000281344;HELLPAR |
| Transcript ID/Name | ENST00000626826;HELLPAR-201 |
| Transcript Length | 205012 |
| Coding Ability | 0.3892 |
| DNA Sequence Corresponding to Peptide | ATGGGAACTGTAGTGGCTAGAGGAGCAATT |
|
Conservation
|
|
|