Basic information for ID2-AS1-209-10aa-1
| Peptide Name | ID2-AS1-209-10aa-1 |
| Genome Position | chr2:8675993-8676022[-] |
| Species | Human |
| Peptide Sequence | MTVCRLFLSS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.22 |
| Relative Molecular Mass | 1318.59 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000235092;ID2-AS1 |
| Transcript ID/Name | ENST00000665989;ID2-AS1-209 |
| Transcript Length | 6025 |
| Coding Ability | 0.3329 |
| DNA Sequence Corresponding to Peptide | ATGACAGTTTGCAGACTTTTCCTTTCCAGT |
m6A
|
Conservation
|
|
|