Basic information for IQCH-AS1-206-10aa-1
| Peptide Name | IQCH-AS1-206-10aa-1 |
| Genome Position | chr15:67407712-67407741[-] |
| Species | Human |
| Peptide Sequence | MIVVTCCYTN |
| Peptide Length | 10 |
| Unique | No (IQCH-AS1-203-10aa-3,IQCH-AS1-205-10aa-1,IQCH-AS1-210-10aa-3) |
| Grand Average of Hydropathicity | 1.36 |
| Relative Molecular Mass | 1308.63 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000259673;IQCH-AS1 |
| Transcript ID/Name | ENST00000657717;IQCH-AS1-206 |
| Transcript Length | 2411 |
| Coding Ability | 0.2418 |
| DNA Sequence Corresponding to Peptide | ATGATTGTGGTGACGTGCTGCTACACTAAT |
m6A
|
Conservation
|
|
|