Basic information for IQCH-AS1-208-10aa-1
| Peptide Name | IQCH-AS1-208-10aa-1 |
| Genome Position | chr15:67430377-67430406[-] |
| Species | Human |
| Peptide Sequence | MLLKKQEATI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.03 |
| Relative Molecular Mass | 1336.63 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000259673;IQCH-AS1 |
| Transcript ID/Name | ENST00000665615;IQCH-AS1-208 |
| Transcript Length | 4130 |
| Coding Ability | 0.3387 |
| DNA Sequence Corresponding to Peptide | ATGCTCCTCAAGAAACAAGAGGCTACAATC |
|
Conservation
|
|
|