Basic information for IQCH-AS1-210-10aa-1
| Peptide Name | IQCH-AS1-210-10aa-1 |
| Genome Position | chr15:67405280-67405309[-] |
| Species | Human |
| Peptide Sequence | MRQVLISLYR |
| Peptide Length | 10 |
| Unique | No (IQCH-AS1-203-10aa-1,IQCH-AS1-205-10aa-2,IQCH-AS1-206-10aa-2) |
| Grand Average of Hydropathicity | 0.36 |
| Relative Molecular Mass | 1440.7 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000259673;IQCH-AS1 |
| Transcript ID/Name | ENST00000670822;IQCH-AS1-210 |
| Transcript Length | 5611 |
| Coding Ability | 0.3823 |
| DNA Sequence Corresponding to Peptide | ATGAGACAGGTACTAATCTCTCTTTACAGA |
|
Conservation
|
|
|