Basic information for ITGA9-AS1-201-10aa
| Peptide Name | ITGA9-AS1-201-10aa |
| Genome Position | chr3:37818499-37818528[-] |
| Species | Human |
| Peptide Sequence | MHGLPAGDIT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.22 |
| Relative Molecular Mass | 1173.33 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000235257;ITGA9-AS1 |
| Transcript ID/Name | ENST00000366441;ITGA9-AS1-201 |
| Transcript Length | 895 |
| Coding Ability | 0.1508 |
| DNA Sequence Corresponding to Peptide | ATGCATGGACTTCCTGCGGGTGATATTACG |
|
Conservation
|
|
|