Basic information for ITGA9-AS1-206-10aa
| Peptide Name | ITGA9-AS1-206-10aa |
| Genome Position | chr3:37806920-37806949[-] |
| Species | Human |
| Peptide Sequence | MALLLPPHCP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.96 |
| Relative Molecular Mass | 1253.52 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000235257;ITGA9-AS1 |
| Transcript ID/Name | ENST00000439246;ITGA9-AS1-206 |
| Transcript Length | 3139 |
| Coding Ability | 0.417 |
| DNA Sequence Corresponding to Peptide | ATGGCCCTACTCTTGCCCCCACACTGTCCC |
|
Conservation
|
|
|