Basic information for ITGA9-AS1-224-10aa-2
| Peptide Name | ITGA9-AS1-224-10aa-2 |
| Genome Position | chr3:37795860-37795889[-] |
| Species | Human |
| Peptide Sequence | MEVVVPSSQG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.39 |
| Relative Molecular Mass | 1194.32 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000235257;ITGA9-AS1 |
| Transcript ID/Name | ENST00000657484;ITGA9-AS1-224 |
| Transcript Length | 3364 |
| Coding Ability | 0.4135 |
| DNA Sequence Corresponding to Peptide | ATGGAAGTTGTAGTGCCTAGTTCACAGGGG |
|
Conservation
|
|
|