Basic information for Jpx-201-10aa-2
| Peptide Name | Jpx-201-10aa-2 |
| Genome Position | chrX:103504159-103504188[+] |
| Species | Mouse |
| Peptide Sequence | MVVRVPLTGL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.49 |
| Relative Molecular Mass | 1246.56 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000097571;Jpx |
| Transcript ID/Name | ENSMUST00000181020;Jpx-201 |
| Transcript Length | 3802 |
| Coding Ability | 0.3448 |
| DNA Sequence Corresponding to Peptide | ATGGTAGTTCGAGTACCACTCACTGGTTTA |
|
Conservation
|
|
|