Basic information for Jpx-204-10aa
| Peptide Name | Jpx-204-10aa |
| Genome Position | chrX:103494583-103494612[+] |
| Species | Mouse |
| Peptide Sequence | MIACYIKNKL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.64 |
| Relative Molecular Mass | 1358.66 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000097571;Jpx |
| Transcript ID/Name | ENSMUST00000183027;Jpx-204 |
| Transcript Length | 1044 |
| Coding Ability | 0.3803 |
| DNA Sequence Corresponding to Peptide | ATGATAGCTTGTTACATTAAAAACAAGTTG |
|
Conservation
|
|
|