Basic information for Jpx-208-10aa
| Peptide Name | Jpx-208-10aa |
| Genome Position | chrX:103509899-103509928[+] |
| Species | Mouse |
| Peptide Sequence | MHTVPLGRTF |
| Peptide Length | 10 |
| Unique | No (Jpx-211-10aa) |
| Grand Average of Hydropathicity | 0.16 |
| Relative Molecular Mass | 1320.6 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000097571;Jpx |
| Transcript ID/Name | ENSMUST00000234690;Jpx-208 |
| Transcript Length | 1115 |
| Coding Ability | 0.5435 |
| DNA Sequence Corresponding to Peptide | ATGCATACTGTGCCATTGGGAAGGACATTC |
|
Conservation
|
|
|