Basic information for KCNMB2-AS1-206-10aa-1
| Peptide Name | KCNMB2-AS1-206-10aa-1 |
| Genome Position | chr3:178935561-178935590[-] |
| Species | Human |
| Peptide Sequence | MKRSEIACVC |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.47 |
| Relative Molecular Mass | 1301.55 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000237978;KCNMB2-AS1 |
| Transcript ID/Name | ENST00000668466;KCNMB2-AS1-206 |
| Transcript Length | 3436 |
| Coding Ability | 0.5934 |
| DNA Sequence Corresponding to Peptide | ATGAAAAGAAGTGAAATTGCCTGTGTTTGC |
|
Conservation
|
|
|