Basic information for KCNQ1OT1-201-10aa-41
| Peptide Name | KCNQ1OT1-201-10aa-41 |
| Genome Position | chr11:2627548-2627577[-] |
| Species | Human |
| Peptide Sequence | MKNRLVVVRG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.15 |
| Relative Molecular Mass | 1333.61 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000269821;KCNQ1OT1 |
| Transcript ID/Name | ENST00000597346;KCNQ1OT1-201 |
| Transcript Length | 91667 |
| Coding Ability | 0.4317 |
| DNA Sequence Corresponding to Peptide | ATGAAGAATAGGTTAGTAGTTGTCAGGGGC |
|
Conservation
|
|
|