Basic information for Kcnq1ot1-201-10aa-21
| Peptide Name | Kcnq1ot1-201-10aa-21 |
| Genome Position | chr7:143242882-143242911[-] |
| Species | Mouse |
| Peptide Sequence | MTFTTPVTLF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.11 |
| Relative Molecular Mass | 1319.68 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000101609;Kcnq1ot1 |
| Transcript ID/Name | ENSMUST00000185789;Kcnq1ot1-201 |
| Transcript Length | 93092 |
| Coding Ability | 0.4223 |
| DNA Sequence Corresponding to Peptide | ATGACATTTACGACACCTGTAACCCTATTC |
m6A
|
Conservation
|
|
|