Basic information for LINC00029-203-10aa
| Peptide Name | LINC00029-203-10aa |
| Genome Position | chr20:63034645-63034674[-] |
| Species | Human |
| Peptide Sequence | MVGSGRGTLG |
| Peptide Length | 10 |
| Unique | No (LINC00029-201-10aa,LINC00029-202-10aa) |
| Grand Average of Hydropathicity | 0.23 |
| Relative Molecular Mass | 1096.26 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000125514;LINC00029 |
| Transcript ID/Name | ENST00000456634;LINC00029-203 |
| Transcript Length | 633 |
| Coding Ability | 0.5577 |
| DNA Sequence Corresponding to Peptide | ATGGTTGGCTCTGGCCGCGGGACCCTGGGC |
m6A
|
Conservation
|
|
|