Basic information for LINC00278-201-10aa
| Peptide Name | LINC00278-201-10aa |
| Genome Position | chrY:3102192-3102221[+] |
| Species | Human |
| Peptide Sequence | MVIQCIFIFN |
| Peptide Length | 10 |
| Unique | No (AL121872.1-202-10aa) |
| Grand Average of Hydropathicity | 2.07 |
| Relative Molecular Mass | 1389.68 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000231535;LINC00278 |
| Transcript ID/Name | ENST00000425031;LINC00278-201 |
| Transcript Length | 528 |
| Coding Ability | 0.428 |
| DNA Sequence Corresponding to Peptide | ATGGTAATTCAATGTATATTTATATTCAAC |
|
Conservation
|
|
|