Basic information for LINC00278-202-10aa
| Peptide Name | LINC00278-202-10aa |
| Genome Position | chrY:3097568-3097597[+] |
| Species | Human |
| Peptide Sequence | MLTIFKTFST |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.9 |
| Relative Molecular Mass | 1350.69 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000231535;LINC00278 |
| Transcript ID/Name | ENST00000444263;LINC00278-202 |
| Transcript Length | 1209 |
| Coding Ability | 0.3598 |
| DNA Sequence Corresponding to Peptide | ATGCTCACTATATTCAAAACATTTTCTACT |
|
Conservation
|
|
|