Basic information for LINC00342-206-10aa-2
| Peptide Name | LINC00342-206-10aa-2 |
| Genome Position | chr2:95817990-95818019[-] |
| Species | Human |
| Peptide Sequence | MGEYFCHLPI |
| Peptide Length | 10 |
| Unique | No (LINC00342-211-10aa-1) |
| Grand Average of Hydropathicity | 0.55 |
| Relative Molecular Mass | 1371.58 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000232931;LINC00342 |
| Transcript ID/Name | ENST00000660416;LINC00342-206 |
| Transcript Length | 3318 |
| Coding Ability | 0.5536 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAATATTTTTGCCATCTACCAATC |
|
Conservation
|
|
|