Basic information for LINC00342-211-10aa-1
| Peptide Name | LINC00342-211-10aa-1 |
| Genome Position | chr2:95814051-95814080[-] |
| Species | Human |
| Peptide Sequence | MGEYFCHLPI |
| Peptide Length | 10 |
| Unique | No (LINC00342-206-10aa-2) |
| Grand Average of Hydropathicity | 0.55 |
| Relative Molecular Mass | 1371.58 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000232931;LINC00342 |
| Transcript ID/Name | ENST00000663557;LINC00342-211 |
| Transcript Length | 4643 |
| Coding Ability | 0.4695 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAATATTTTTGCCATCTACCAATC |
m6A
|
Conservation
|
|
|