Basic information for LINC00343-201-10aa
| Peptide Name | LINC00343-201-10aa |
| Genome Position | chr13:105729818-105729847[+] |
| Species | Human |
| Peptide Sequence | MYQIFCPIRG |
| Peptide Length | 10 |
| Unique | No (LINC00343-282-10aa-2) |
| Grand Average of Hydropathicity | 0.49 |
| Relative Molecular Mass | 1389.64 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000226620;LINC00343 |
| Transcript ID/Name | ENST00000414368;LINC00343-201 |
| Transcript Length | 864 |
| Coding Ability | 0.2859 |
| DNA Sequence Corresponding to Peptide | ATGTATCAGATATTCTGCCCAATCAGAGGC |
|
Conservation
|
|
|