Basic information for LINC00343-218-10aa
| Peptide Name | LINC00343-218-10aa |
| Genome Position | chr13:105731171-105731200[+] |
| Species | Human |
| Peptide Sequence | MVIFLSSLWG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.81 |
| Relative Molecular Mass | 1314.53 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000226620;LINC00343 |
| Transcript ID/Name | ENST00000654132;LINC00343-218 |
| Transcript Length | 2295 |
| Coding Ability | 0.4885 |
| DNA Sequence Corresponding to Peptide | ATGGTAATATTTTTGTCTTCACTTTGGGGA |
|
Conservation
|
|
|