Basic information for LINC00343-241-10aa
| Peptide Name | LINC00343-241-10aa |
| Genome Position | chr13:105754211-105754240[+] |
| Species | Human |
| Peptide Sequence | MGETFCNLLI |
| Peptide Length | 10 |
| Unique | No (LINC00343-289-10aa,LINC00343-317-10aa) |
| Grand Average of Hydropathicity | 1.12 |
| Relative Molecular Mass | 1302.55 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000226620;LINC00343 |
| Transcript ID/Name | ENST00000658151;LINC00343-241 |
| Transcript Length | 2491 |
| Coding Ability | 0.3545 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAAACTTTTTGCAATCTACTCATC |
|
Conservation
|
|
|